Virus du papillome humain (VPH) types …

Virus du papillome humain (VPH) types ...

papillomavirus humain (HPV) de types 16, 18, 31, 45 charges d’ADN et HPV-16 l’intégration dans les infections persistantes et transitoires chez les jeunes femmes

Contexte

le fardeau du VPH est un prédicteur de haute qualité néoplasie intraépithéliale cervicale et le cancer. L’histoire naturelle de la charge du VPH chez les jeunes femmes étant récemment exposées au VPH est décrite dans le présent document.

Méthodes

Un total de 636 étudiantes universitaires ont été suivis pendant 2 ans. spécimens cervicaux avec HPV-16, -18, -31, -45 ou ADN par consensus PCR ont ensuite été évalués avec des tests de PCR en temps réel de type spécifique et ß-globine. régression des risques proportionnels a été utilisé pour estimer les ratios de risque (HR) de la clairance de l’infection. équations d’estimation généralisées évaluées si les charges de VPH était prédictive de l’infection par le VPH lors de la visite suivante.

Résultats

les charges de HPV étaient constamment plus élevés chez les femmes lt; 25 ans, et ceux qui avaient des partenaires sexuels multiples, les infections multiples de type HPV et les fumeurs. l’intégration HPV-16 a été rencontrée que dans un seul échantillon. clairance de l’infection a été plus rapide chez les femmes à tertiles inférieurs de HPV-16 (HR = 2,8, IC à 95%: 1,0 à 8,1), HPV-18 (HR = 3,5, IC à 95%: 1,1 à 11,2) ou combiné (HR = 2,4, IC à 95%: 01/08 à 06/02) charges ADN. La relation entre le HPV-16 et HPV-18 charges d’ADN et de la clairance de l’infection a suivi un modèle dose-réponse claire, après ajustement pour l’âge et le nombre de partenaires sexuels. GEE Rapports de cotes pour HPV persistance du milieu et tertiles supérieurs par rapport au tertile inférieur étaient de 2,7 et 3,0 pour le VPH-16 et 3,8 et 39,1 pour le VPH-18, respectivement. Il n’y avait pas d’association entre le HPV-31 ou -45 charges d’ADN et de la persistance.

Conclusions

L’association entre la charge du VPH et de la persistance est pas uniforme dans les génotypes génitaux à haut risque. l’intégration HPV-16 a été démontré que rarement chez les jeunes femmes.

Contexte

Les femmes sexuellement actives sont à risque d’infection génitale par le virus du papillome humain (VPH). La plupart des infections génitales à HPV régressent dans les deux ans et seule une minorité de femmes développeront une infection persistante à HPV qui pourraient éventuellement causer des néoplasies intraépithéliales cervicales (CIN). CIN de haut grade (grades 2 et 3) sont des précurseurs du cancer invasif du col utérin. Bien que la mesure de la persistance a une valeur pronostique dans la compréhension de l’histoire naturelle de l’infection par le VPH et CIN, il y a un besoin pour l’étude des critères virologiques supplémentaires pour aider à la prédiction du risque.

HPV-16 DNA charge semble être associée de façon indépendante avec CIN de haut grade et un cancer invasif [1 – 6]. La plupart des études ont également indiqué que la charge du VPH était un marqueur auxiliaire pour une infection persistante à HPV [3. 7-11]. les infections au VPH-16 ou 18 sont effacées plus lentement que les infections causées par d’autres types à haut risque [12]. Étant donné que le comportement biologique des types de VPH diffèrent, la valeur prédictive de la persistance de la charge ADN du VPH peut également varier entre les types [13]. Nous savons peu de choses sur les charges virales de type spécifique et leur relation avec la clairance de l’infection par le VPH. En outre, la plupart des études sur la charge virale HPV ont mis l’accent sur les femmes âgées à risque de CIN. L’évaluation de la charge virale HPV dans récemment infectés par les jeunes femmes reste largement inexploré.

Intégration des types de VPH à risque oncogène élevé (HR-HPV) est considéré comme un événement clé dans la progression de CIN vers un cancer invasif [14]. Des données récentes jette un doute sur l’idée que l’intégration du virus dans le génome hôte est un marqueur de progression vers CIN2 / 3 [15 – 20]. En effet, intégré l’ADN de HPV-16 peut être détectée chez des femmes atteintes de CIN 1 ou échantillons cervicaux normaux, bien que ces résultats ne sont pas confirmées par d’autres [21]. Il est important de déterminer si l’intégration du VPH se produit tôt dans le cours de l’infection par le VPH pour évaluer sa contribution à la cancérogenèse. Dans l’ensemble, l’évaluation longitudinale de la charge HR-HPV et de l’intégration dans l’histoire naturelle de l’infection HPV considérant divers résultats viraux tels que la clairance et de la persistance a reçu peu d’attention jusqu’à présent. En 1996, nous avons commencé une étude de cohorte prospective de jeunes femmes qui fréquentent un collège à Montréal, Canada, pour étudier les déterminants épidémiologiques des infections à HPV cervicales persistantes et transitoires [22. 23].

L’objectif de l’étude était d’évaluer prospectivement, dans cette cohorte de jeunes femmes, au cours du temps et d’association entre le HPV-16 l’intégration, les charges HPV-16, 18, 31 et 45 l’ADN, et les résultats viraux spécifiques de type.

Méthodes

Les sujets d’étude

Les étudiantes qui fréquentent soit l’Université McGill ou l’Université Concordia Cliniques ont été invités à participer si elles destinées à rester à Montréal pour les 2 prochaines années et avaient pas été traités pour la maladie du col utérin au cours des 12 derniers mois [22]. Un total de 636 étudiantes universitaires ont été recrutés entre Novembre 1996 et Janvier 1999, et ont été suivis pendant 2 ans; avec la clinique visite tous les 6 mois. Des informations détaillées ont été obtenus lors de l’inscription par l’intermédiaire d’un questionnaire auto-administré et les changements dans les caractéristiques de style de vie ont été obtenues lors de chaque visite de suivi avec un questionnaire abrégé, comme décrit précédemment [22]. Deux échantillons du col utérin ont été recueillies avec un biosampler cervical Accelon à chaque visite. Un frottis de Papanicolaou a été préparé avec le premier échantillonneur. Les cellules restantes ainsi que celles recueillies avec le second échantillonneur ont été traités pour le dépistage du VPH. Le consentement éclairé a été obtenu de tous les participants à l’étude. L’étude a été examiné et approuvé par les comités d’éthique de chaque établissement participant.

test HPV

le test ADN du HPV a été décrit précédemment [22]. En bref, cinq ul d’échantillon d’ADN purifié avec des colonnes QIAamp (Qiagen, CA) ont d’abord été amplifiés pour β-globine PC04 / avec des amorces GH20 pour démontrer l’intégrité de l’ADN extrait. spécimens β-globine-positifs ont ensuite été testés avec le L1 amorces consensus de HPV MY09 / MY11 et HMB01 utilisant AmpliTaq or (Roche Diagnostic Systems, Laval, Canada) et avec le test de transfert de ligne pour la détection de 27 génotypes de HPV génitaux [22].

HPV 16, 18, 31 et 45 la charge virale

Un total de 382 spécimens collectés à partir de 183 participants étaient positifs pour le VPH-16, -18, -31 ou -45 ADN. Dix-neuf femmes ont été infectées simultanément avec deux ou plusieurs de ces génotypes. L’ADN extrait de ces échantillons a été criblée pour la présence d’inhibiteurs de la PCR par amplification du contrôle interne pour le HPV-16, HPV-18, HPV-31 ou HPV-45 et pour l’ADN ί-globine, comme décrit précédemment [18 24 ]. La présence d’inhibiteurs de la PCR a été suspectée lorsque 1000 copies d’au moins une commande interne généré un signal correspondant à moins de 700 copies, comme décrit précédemment [25]. Tous les échantillons étaient exempts d’inhibiteurs. Deux pl de l’échantillon traité ont été testés en double pour la quantification de l’ADN ί-globine pour estimer la teneur en cellules d’échantillons 18. [24]. HPV-16 E6 et E7 du HPV-18 l’ADN a été quantifié en utilisant un protocole standard [26]. L1 du HPV-31 l’ADN a été mesurée par le test décrit par weissenborn et al. [27]. HPV 45 E6 ADN a été amplifié par PCR dans un cycleur de lumière et un système de détection (Roche Molecular Systems) dans un mélange réactionnel de 20 ul contenant 1 × DNA Master Mix sonde d’hybridation avec le Fast Start Taq ADN polymerase (Roche Molecular Biochemicals), 0,3 pmoles de chaque amorce HPV 45 E6 45-F (position de nucleotide 463-486; TTAAGGACAAACGAAGATTTCACA 5′-3 ‘) et 45 E6-R (position de nucleotide 670-647; 5’- ACACAACAGGTCAACAGGATCTAA-3 ‘), et 50 nM de sonde fluorogénique 45 E6-TM (position de nucleotide 491-514; FAM-5′-AGCTGGACAGTACCGAGGGCAGTG-3’-TAMRA). Les paramètres de cycle comprenaient une étape d’activation à 95 ° C pendant 10 min suivi par 50 cycles à 95 ° C pendant 15 s, 60 ° C pendant 5 s et 65 ° C pendant 45 secondes. Pour chacun des quatre génotypes analysés, les seuils de cycle obtenu pour chaque échantillon ont été comparées à celles d’une courbe de titrage obtenue par des dilutions en série de dix fois de HPV 16, 18, 31 ou 45 plasmides dans une quantité fixe de 75 ng du génome humain ADN (Roche Diagnostics) dans 10 mM de Tris-HCl [pH 8,2]. Chaque essai systématiquement détecté 10 copies HPV ADN (données non présentées). la charge virale HPV ont été exprimées comme le nombre de copies d’ADN de HPV par cellule.

HPV-16 essais d’intégration

La présence de HPV-16 intégré a été étudiée par des tests de PCR en temps réel de ciblage E6 et E2, comme décrit précédemment [28]. Etant donné que la disruption du gène E2 se traduit souvent par l’intégration du HPV, la détection d’une plus grande quantité de HPV 16 E6 par rapport à E2 de HPV-16 suggèrent fortement la présence d’ADN de HPV-16 intégré [16 17]. Deux pi de chaque échantillon traité a été testé en double dans chaque HPV 16 E6 et E2 dosages. les seuils de cycle ont été comparés à ceux des dilutions en série de dix fois d’un plasmide de HPV-16 dans une quantité fixe de 2000 copies de l’ADN génomique humain (Roche Diagnostics). Nous avons supposé que le HPV-16 l’ADN a été intégré dans le génome de l’hôte si le rapport entre le nombre de copies du HPV-16 E6 et E2 (HPV-16 E6 / E2) dans un échantillon est deux ou plus [18. 28. 29].

l’intégration du HPV-16 a été confirmée par PCR des sites de restriction (LR-PCR), une technique de séquençage qui démontre la présence de jonctions de HPV-16 et l’ADN humain dans le même amplicon [30]. PCR Brièvement, 9 amorces 16 spécifiques du HPV couvrant l’ensemble du HPV-16 génome ont été combinés séparément avec des sites d’oligonucléotides 6 de restriction conçus pour recuire des sites de restriction choisies dans le génome humain, en deux étapes semi-nichée réalisée dans un 9.600 thermique Cycler. Amplicons ont été transférées dans un gel d’agarose 2% coloré au bromure d’éthidium. Lorsque les bandes visibles ont été obtenus, PCR-séquençage double brin directe a été réalisée par une méthode du cycle de séquençage (terminator kit de réaction prêt BigDye, Perkin-Elmer) en utilisant les amorces internes et une amorce de séquençage sur 20 ng d’amplicon purifié.

Méthodes statistiques

Nous avons utilisé des tests de Wilcoxon rang de somme pour comparer les charges virales de type spécifique entre les visites. La force des corrélations entre les mesures de charge virale transformation logarithmique à l’entrée et des visites de suivi pour les quatre types de VPH a été mesurée en utilisant le coefficient de corrélation de Pearson (r). Les moyennes géométriques des charges virales ont été calculés en fonction de certaines caractéristiques rapportées lors de la visite d’index de la première positivité pour un type de HPV spécifique. La technique de Kaplan-Meier a été utilisée pour estimer la probabilité cumulée de la clairance de l’infection en fonction du temps écoulé depuis l’inscription à l’étude. régression des risques proportionnels a été utilisé pour estimer le taux relatif de la clairance de l’infection de type spécifique, stratifié par tertiles des distributions de charge virale respectifs [31]. Logistique équations d’estimation généralisées (GEE) ont été utilisés pour évaluer si la charge virale mesurée à une visite donnée était un prédicteur de l’infection persistante à HPV à la visite suivante [32. 33]. Brut et ajusté (pour l’âge et les partenaires sexuels) odds ratios (OR) entre HPV persistante lors de la visite (t) et la charge virale lors de la visite (t-1) dans des périodes déterminées de suivi ont été calculés pour mesurer l’ampleur des associations longitudinales .

Résultats

Les 636 femmes inscrites dans la cohorte McGill-Concordia ont contribué 2694 terminé visites (moyenne de 4,2 visites / sujet) au cours d’une moyenne de 21,5 mois de suivi. Presque tous les échantillons cervicaux (n = 2626, 97,4%) ont été adaptés pour le dépistage du VPH. Parmi ceux qui sont inscrits dans la cohorte, 68% ont terminé les 5 visites, contribuant un total de 13.353 femmes-mois de suivi. L’âge moyen des participants était de 23 ans (médiane, 21 ans, portée, 17-42 ans). Quatre femmes sur cinq ont indiqué qu’ils étaient de race blanche, et un sur quatre sont des fumeurs. Près de la moitié des participants avaient plus de 4 partenaires sexuels. La prévalence (tout HPV = 29%, HPV à haut risque = 22%), les taux d’incidence cumulée (d’incidence cumulative d’un HPV = 36% et un risque élevé HPV = 29% en 2 ans) et la durée moyenne des infections au VPH ont été signalés ailleurs [22]. lésions intraépithéliales squameuses de bas grade (SIL) de haute qualité et ont été trouvés dans seulement 4 et 49 frottis vaginaux, respectivement, qui ont empêché l’analyse de l’association entre les charges de VPH et SIL.

Des échantillons positifs pour le VPH-16 (n = 220 de 104 femmes, moyenne de 2,1 samples / femme), HPV-18 (n = 80 de 43 femmes, moyenne de 1,9 samples / femme), HPV-31 (n = 75 de 36 les femmes, la moyenne de 2,1 échantillons / femme), ou HPV-45 (n = 33 de 19 femmes, moyenne de 1,7 échantillons / femme), ont encore été testés avec des tests de PCR quantitatives en temps réel de type spécifique. Dix-neuf échantillons contenaient plus d’un des génotypes étudiés. Statistiques descriptives des charges de HPV transformation logarithmique stratifiées par référence et des points de temps de suivi sont présentés à la figure 1. Sauf pour les fluctuations du VPH-45 charges, ce qui pourrait être dû au petit nombre d’échantillons, nous avons observé aucune between- significative visitez la variation entre les charges virales de type spécifique.

charges de HPV (HPV ADN copies par cellule) à l’inscription et à des visites de suivi (total 5 visites) chez les femmes HPV positives pour les 4 génotypes étudiés (axe Y en échelle logarithmique). La longueur de chaque case correspond à la gamme interquartile, avec la limite supérieure de la boîte représentant limite 75e et inférieure au 25e percentile. La ligne horizontale dans la case indique la valeur médiane. Les valeurs extrêmes sont représentées dans les cercles en dehors des boîtes.

Afin d’étudier la consistance de la charge virale de type spécifique au fil du temps nous avons calculé les coefficients de corrélation pour les mesures prises dans toutes les paires possibles de visites (tableau 1). les charges de HPV étaient significativement corrélées que lors de l’examen des visites consécutives. La force entre-visite des corrélations semblait devenir plus faible que le temps avançait. corrélations fortes entre les visites consécutives ont été trouvés chez les femmes par le VPH-16 infection. Les coefficients de corrélation de charges HPV étaient non significatifs lors des visites de 12 mois d’intervalle ont été comparés, sauf lorsque la charge virale pour les quatre types de VPH ont été combinés (tableau 1 et figure 2).

Entre-visiter coefficients de corrélation des mesures de la charge de HPV et combinés spécifiques de type viral à l’entrée et les visites de suivi dans la cohorte McGill-Concordia.

les charges de HPV ont été mesurées avec des tests de PCR spécifiques de type et exprimées en transformation logarithmique avant de calculer les corrélations. Coefficients de corrélation Pearson sont présentés avec le nombre de visites paires conjointement positifs pour le type ou la combinaison indiquée entre parenthèses. ND: non déterminé parce que seulement 2 paires étaient évaluables.

* Indique une signification au niveau de signification de 5%; ** Indique la signification au niveau de signification statistique de 1%.

Entre-visiter graphiques de corrélation des mesures de charge virale de quatre types de VPH combinés (HPV-16, 18, 31, 45) lors de l’inscription et le suivi des visites (voir matériels et méthodes). Par exemple, le graphique en haut à gauche montre la charge virale à l’entrée en fonction de la charge virale à 6 mois, le graphique inférieur gauche montre la charge virale à l’entrée en fonction de la charge virale à 24 mois.

Le tableau 2 présente une charge virale moyenne géométrique et les intervalles de confiance respectifs de 95% selon les caractéristiques déterminées lors de la première visite, dans lequel la positivité a été détectée pour chaque type de HPV donné. charges HPV ADN ont été légèrement plus élevé chez les femmes de moins de 25 ans, avec gt; partenaires sexuels 2 à vie, qui étaient utilisatrices de contraceptifs oraux réguliers, et avec le VPH co-infections séquentielles mais pas ceux avec les co-infections simultanées. Cependant, les intervalles de confiance étaient en grande partie de chevauchement pour la plupart des comparaisons. charges HPV ADN ne montrent pas une tendance constante de variation selon les catégories de fumeurs ou l’utilisation du préservatif.

Moyens de charge virale HPV selon certaines caractéristiques à la première occurrence de la positivité pour un type de VPH donnée

* Défini au moment de la première occurrence de la positivité pour le type de HPV indiqué.

# Coinfection Concurrent défini comme la détection de plus d’un type de VPH dans l’échantillon de cellules cervicales recueillies lors de la première visite lorsque le type indiqué a été trouvé. coinfection séquentielle définie comme types de HPV supplémentaires détectés à différentes visites que celui où le type indiqué a été trouvé.

Une fois détectés, 30% du HPV-16, 44% des HPV-18, 63% des HPV-31 et 55% du VPH-45 infections défrichées dans les 6 mois. Le tableau 3 montre les taux relatifs de la clairance de l’infection par le VPH selon la charge ADN HPV pour chaque génotype classé en tertiles. Pour HPV-16 et HPV-18, la clairance de l’infection était inversement associée à la charge virale, mais aucune tendance claire d’association dégage pour HPV-31 et HPV-45. En raison de la prépondérance de HPV-16 et HPV-18 dans la cohorte de l’association globale entre les charges virales combinées et la clairance a maintenu le motif inverse vu avec les derniers types. La figure 3 montre les taux cumulatifs de positivité par tertile de la distribution de la charge virale combinée.

* Les taux relatifs de type spécifique et la clairance combinée de l’infection par le VPH selon la charge virale

* Utilisation de risques proportionnels de Cox régression. Taux de dégagement pour la troisième tertile de la charge virale (la plus élevée) pris comme référent. Pour l’analyse des types combinés les observations ne sont pas indépendants et nécessitaient un estimateur de variance robuste. les taux relatifs ajustés ont été estimés dans les modèles qui ont inclus l’âge et les partenaires sexuels comme covariables.

Taux cumulatif de positivité pour les infections avec des types de HPV 16, 18, 31, et 45 selon les tertiles de la charge virale cumulative pour ces 4 types. Unité d’analyse est un épisode d’infection individuelle, ce qui rend les observations pas indépendant comme un sujet peut contribuer de multiples épisodes. La ligne pointillée: tertile supérieur; ligne pointillée: moyenne; ligne continue: tertile inférieur de la charge virale.

L’association entre le HPV charge virale et la persistance de l’infection a été étudiée pour chaque génotype en calculant brut et ajusté (pour l’âge et le nombre de partenaires sexuels) ORs de GEE (tableau 4). Persistance du VPH était significativement associée à des niveaux de charge virale intermédiaires et élevées à une visite précédente pour HPV-16 et HPV-18. Il n’y avait aucun effet constant de la charge virale sur la persistance de HPV-31 et HPV-45 infections.

Rapports de cotes pour les associations entre l’infection persistante à HPV à la visite (t) et la charge virale à la visite (t-1) estimée au moyen de modèles GEE

Les événements sont considérés comme des infections à HPV avec le type déclaré à des visites au temps t = 2, 3, 4 et 5 en fonction de la charge virale déterminée lors de la visite précédente.

* Ajusté pour l’âge et le nombre de partenaires sexuels

Nous avons ensuite étudié si persistante par HPV-16 infection et / ou élevés HPV-16 charges virales chez les jeunes femmes pourraient se traduire par l’intégration du HPV-16 l’ADN dans le génome humain. Quarante-huit échantillons ont été exclus de cette analyse parce qu’ils contenaient lt; 15 copies de HPV-16 ADN par ul d’ADN extrait. HPV-16 E6 et E2 de l’ADN ont ainsi été quantifiées sur les 172 échantillons restants HPV-16-positives qui ont eu suffisamment charge virale élevée pour permettre une mesure fiable de l’intégration. La moyenne HPV-16 E6 charge virale sur les échantillons sélectionnés était de 57,5 ​​± 324,6 copies d’ADN par cellule (intervalle de confiance à 95%, 8,6 à 106,4; médiane, 0,92, intervalle 0.0001-4084.7 copies par cellule). Le ratio moyen HPV-16 E6 / E2 était de 0,97 ± 0,25 (95% intervalle de confiance, 0,93 à 1,01; médiane, 0,97; intervalle, 0,5 à 2,48). Sur les 172 échantillons analysés, 169 ont eu un rapport de HPV-16 E6 / E2 lt; 1,5, deux échantillons avaient HPV-16 un rapport E6 / E2 gt; 1,5 et lt; 2.0 (1.54 et 1.70) et avait un rapport supérieur à 2. Les échantillons recueillis lors des visites consécutives des deux participants au VPH-16 ratios de 1,54 et 1,70 a donné des rapports HPV-16 E6 / E2 proche ou inférieure à 1,0 (données non présentées ). Le seul échantillon prélevé d’un participant qui a généré un HPV-16 E6 / E2 ci-dessus 2 (rapport de 2,48) contenait 0,94 copie / cellule de HPV-16 E6 ADN et a été obtenu lors de la dernière visite. HPV-16 n’a été détectée que lors de la dernière des cinq visites fréquentées par ce participant. frottis cytologiques normaux ont été obtenus dans les quatre premières visites pour ce participant tandis qu’un SIL frottis de bas grade a été obtenu lors de la cinquième visite. LR-PCR a été réalisée sur les 18 échantillons qui ont produit un rapport ≥1.2 HPV 16 E6 / E2. Malgré l’utilisation de plusieurs combinaisons d’amorces, nous ne pouvions pas démontrer la présence de jonctions cellulaires et HPV dans aucun des échantillons testés. Une quantité minimale de 35 ug d’ADN cellulaire par test a été analysé pour le seul échantillon avec un rapport gt; 2, sans succès, ce qui aurait pu limiter notre capacité à séquencer jonctions d’ADN HPV humain.

Depuis que nous avons détecté HPV-16 formes intégrées une seule fois, nous avons étudié si la quantité d’ADN cellulaire introduit dans les essais quantitatifs entravé notre capacité à mesurer le VPH-16 E6 et E2, tel que rapporté par un autre groupe [34]. Lorsque des mélanges de épisomique du HPV-16 et l’ADN extrait des cellules SiHa ont été testées, on observe des interférences avec la quantification du HPV 16 E6 et E2 avec l’ADN extrait de 10 6 et de 10 4 cellules SiHa, respectivement (données non montrées). Un millier de copies de 16 l’ADN du HPV épisomal a été détecté sans perte de signal lorsqu’il est testé dans un mélange d’ADN extrait à partir de 200.000 cellules dans le dosage de HPV 16 E2 et jusqu’à 40.000 cellules dans le 16 E6 du HPV test (Tableau 5 ). L’interférence de HPV-16 quantification par l’ADN d’entrée était pas un problème dans notre étude puisque tous les échantillons testés contenaient ≤39,200 copies de l’ADN cellulaire par test.

L’interférence de fond de l’ADN humain dans la quantification de l’ADN de HPV-16 avec des essais de PCR en temps réel HPV 16 E6 et HPV 16 E2.

Nombre de copies de l’ADN humain

Discussion

Nous avons mesuré le VPH charge d’ADN pour quatre types à haut risque (16, 18, 31, 45) avec la PCR en temps réel sur un ensemble d’échantillons prélevés prospectivement chez les jeunes femmes. Ces quatre génotypes sont parmi les plus fréquemment détectés dans le cancer du col utérin. Contrairement aux études transversales des femmes âgées, les quatre génotypes du HPV ont été détectés à des charges similaires et ne sont pas sensiblement différentes entre les femmes ayant des infections de type uniques et multiples 1. 11. [35].

Les tests de PCR quantitatives en temps réel, nous avons utilisé pour estimer les charges de HPV étaient spécifiques et reproductibles [25. 28]. Le nombre de copies d’ADN de HPV a été normalisée pour le contenu cellulaire par quantification de l’ADN de β-globine. Le dosage de l’intégration du HPV-16 a été conçue compte tenu de la diversité génétique du HPV-16 [28 36]. En utilisant des essais quantitatifs spécifiques du type permis d’isoler l’effet des charges de type HPV dans plusieurs infections de type. La conception de cohorte a également permis de tester des corrélations longitudinales entre des paires de visites. mesures cohérentes pour les types de HPV 16, 18, et 31 ont été présentés pour les cinq visites avec des preuves de corrélation entre les charges entre les visites au sein de sujets, chaque fois que la précision statistique était suffisamment élevée.

Tel que rapporté par d’autres, plus jeune femme (lt; 25 ans) abritaient des charges de VPH plus élevés que ceux gt; 25 ans [1]. Ces femmes ont été éventuellement exposés au VPH pendant qu’ils étaient immunologiquement naïve au VPH. Nous avons également observé un fardeau du VPH peu plus chez les fumeurs actuels et anciens, mais pas toujours pour les quatre types de VPH. Cette constatation peut être expliquée par une éventuelle immunité à médiation cellulaire défectueuse contre le VPH induite par le tabac [37]. Les résultats de cette cohorte, ainsi que ceux d’autres suggèrent que le tabagisme peut augmenter la durée de risque élevé infection par le VPH [23. 38]. Ceci pourrait être expliqué en partie par l’augmentation de la réplication du VPH chez les femmes exposées au tabac.

Bien que l’utilisation régulière de préservatifs protège contre les infections sexuellement transmissibles les plus, ils ne sont pas aussi efficaces contre l’infection par le VPH [39]. Nous avons trouvé une tendance à l’utilisation systématique du préservatif pour avoir plus élevé des charges de HPV pour la plupart des génotypes. Ces résultats pourraient être biaisés parce que l’utilisation de préservatifs peut être associée à des comportements sexuels à risque ou de l’exposition à de nouveaux partenaires sexuels [23]. L’utilisation du préservatif a été associé dans une étude avec la régression de la CIN et la clairance du HPV [40]. Bien que l’utilisation de la contraception orale n’a pas modifié la durée de l’infection par le HPV à haut risque dans notre cohorte [23], le VPH-18 charges d’ADN ont été nettement augmenté chez les femmes sur les contraceptifs oraux. Les contraceptifs oraux peuvent aussi être un proxy pour un plus grand nombre de partenaires sexuels.

charges de HPV-16 et -18 étaient de bons prédicteurs de la durée de l’infection par ces types, mais le même constat n’a pas eu lieu pour le VPH-31 et -45. HPV-16 charge a été rapportée par d’autres d’être un facteur prédictif de la persistance ou de lésions de HPV-18, 31 ou 33 charges [13]. Il y avait une relation dose-réponse claire entre la charge du VPH et la persistance du HPV-16 et HPV-18 infections. Nous avons constaté que les taux de clairance dépendait en grande partie sur le niveau de charge de HPV. interactions Viral-hôte jouent un rôle influent dans le jeu des infections virales [41]. HPV a développé plusieurs mécanismes pour échapper au système immunitaire de l’hôte [42]. Les différences fonctionnelles entre les protéines HPV-codées pourraient également expliquer pourquoi certains types et variantes ont une meilleure condition virale avec une plus grande capacité à persister [14. 41. 43]. Pour HPVs 16 et 18, les charges virales étaient plus avec le VPH co-infections à différentes visites (séquentielles) que la co-infection simultanée. Dans des études récentes, deux ou plusieurs types de HPV oncogènes diagnostiqués simultanément ne confèrent pas un risque supplémentaire de lésions en développement [44. 45]. Tout mais une étude a confirmé que soutenue ou une augmentation de la charge virale, en particulier par le VPH-16, étaient prédictifs d’une infection persistante [3. 5. 8. 11]. Dans une cohorte de près de 6.000 femmes en France, les femmes avec des charges de VPH supérieures à 10 pg / ml étaient moins susceptibles d’éliminer l’infection, quel que soit l’âge des participants [8]. De même, une autre étude de cohorte menée aux Pays-Bas a indiqué que les femmes à faible HPV-16 charges étaient cinq fois plus susceptibles de dégager HPV-16 infection [5]. Dans une troisième étude menée au Brésil, il y avait une relation dose-réponse entre l’augmentation de la charge virale et le risque d’incident frottis anormal au fil du temps [3].

l’intégration du HPV-16 se traduit souvent par la disruption du gène E2, conduisant à l’expression incontrôlée de HPV-16 oncoprotéines [14 17]. l’intégration HPV-16 pourrait donc se produire au cours de la persistance HPV-16 infection et augmenter la probabilité de progression vers des lésions de grade supérieur. L’intégration du génome du HPV-16 était censé se produire au stade CIN-2,3 et au-delà [14]. Des études récentes soutiennent que l’intégration peut se produire même en l’absence de CIN [15 28]. Dans une étude menée chez les femmes l’âge de 15 à 19 ans [46], la rupture du gène E2 a été démontrée dans un maximum de 25% des incidents HPV-16 infections, ce qui suggère que le VPH-16 E2 perturbation a été un événement commun survenant tôt dans l’infection . Contrairement à cette dernière étude, la perturbation HPV-16 E2 était rare dans notre population d’étude, peut-être parce que contrairement à Collins et al [46] qui a étudié le gène E2 entier pour perturber notre test uniquement axé sur la région charnière de E2. Alors que la perturbation de E2 est supposée se produire plus fréquemment dans les premières phases de l’infection chez les jeunes femmes au moins une autre étude sur les femmes âgées ont suivi longitudinalement, observé environ 50% des femmes ayant des infections persistantes ou transitoires d’avoir mélangé les formes intégrées et épisomiques [ 11]. Cependant, contrairement à notre étude, plus de 50% de ces participants avaient des anomalies du test de Pap. En outre, l’intégration du HPV n’a pas été trouvée être associée à la persistance [11]. Les résultats d’autres cohortes sont nécessaires pour évaluer le taux d’intégration et de clarifier le rôle de l’intégration du VPH sur la persévérance aux premiers stades de l’infection.

Il y a des limites à notre étude. Nous ne pouvons pas exclure la possibilité que nous avons sous-estimé le VPH-16 en raison de l’intégration HPV-16 perturbations lors de l’intégration dans les zones en dehors de la région charnière E2. Néanmoins, le HPV-16 E2 charnière est le site le plus fréquemment perturbé dans les études menées en Amérique du Nord [16].

La sensibilité analytique des tests PCR en temps réel pour la quantification de HPV 16 E6 et E2 de l’ADN utilisé dans cette étude a été démontré précédemment et se sont avérés excellents [18. 28. 26]. Ces réactifs ont été optimisées afin d’éviter toute influence du polymorphisme viral sur l’efficacité du HPV-16 amplification de l’ADN [28]. Néanmoins, la sensibilité clinique et de la spécificité de ces tests pour détecter l’intégration du HPV ont pas été complètement évaluées. des expériences de reconstitution ont démontré que l’intégration du HPV-16 est détectée par des essais de PCR en temps réel de mesure E6 et E2 en cas d’intégration du HPV-16 sont des formes de 100 fois supérieure à épisomique d’ADN de HPV-16 [47]. Théoriquement, un HPV-16 rapport E6 / E2 ci-dessus 1.0 pourrait suggérer l’intégration. Cependant, les travaux antérieurs sur HPV-6, HPV-16 et -33 ont démontré que les ratios HPV E6 / E2 ci-dessous 2.0 résultats de dosage de la variabilité plutôt que de véritables différences entre les quantités E6 et E2 [2. 18. 29. 34]. tests PCR en temps réel peuvent ainsi être faussement négatif pour HPV-16 l’intégration dans la présence de faibles quantités de formes intégrées et des quantités élevées de formes épisomiques.

On n’a pas pu confirmer la présence de HPV-16 l’intégration avec une technique standard d’identifier la présence de jonctions ADN HPV humain dans le seul échantillon avec un rapport de HPV-16 E6 / E2 au-dessus de 2,0. Toutefois, la quantité d’échantillon qui peut être analysé était limitée. Un récent rapport en utilisant une technique similaire pour démontrer la présence de jonctions de HPV humain n’a pas trouvé le VPH-16 l’intégration dans des échantillons provenant de femmes avec SIL de bas grade [21]. des tests de PCR en temps réel peuvent être utiles pour détecter les formes de HPV intégrées, mais d’autres études sur le plus grand nombre de spécimens comparant différentes techniques pour la détection des HPV-16 intégré doivent être menées.

Dans notre étude, quelques femmes avaient des frottis anormaux, ce qui réduit notre pouvoir pour tester les associations entre la charge du VPH et les résultats de la lésion. L’intervalle de temps entre les visites peuvent influencer l’évaluation de la persistance et de la clairance. La majorité des femmes dans notre cohorte retourné dans les 6 mois de chaque visite et il y avait seulement une petite proportion de femmes dont l’intervalle de temps entre les visites prolongé plus d’un an [22]. L’association entre les charges et la persistance virale plus élevée ne serait faussé si elle avait été associée différemment avec le temps entre les visites. Étant donné que les participants ignoraient leur statut HPV et la charge virale, ce scénario est peu probable. Il est également peu probable que leur comportement et d’autres facteurs de risque vont changer dans ce court laps de temps. Les mêmes associations entre les charges de HPV et la persistance ont été obtenus lorsque le VPH persistance a été défini de manière plus rigoureuse en utilisant trois visites HPV positives consécutives pour le même type.

la détection consécutive de l’ADN du VPH est due soit à la réplication virale en cours, la réactivation d’infections latentes ou de nouvelles infections [48. 49]. La conception de notre étude ne peut pas discriminer entre ces trois possibilités. Les participants considérés comme ayant une infection persistante aurait pu en effet, été réinfecté avec un autre isolat du même type de VPH. Cependant, cela semble peu probable parce que les femmes atteintes d’une infection persistante ont tous été infectés par la même variante du VPH intratypique. Les deux infections à HPV prévalentes et incidentes ont été inclus dans notre analyse de la persistance, l’augmentation de la puissance de nos analyses. Bien qu’il ne peut pas avoir une implication directe sur la clairance du VPH, la durée exacte des cas prévalents est inconnue. En les incluant, nous aurions pu introduire un biais parce qu’une plus grande proportion des infections à VPH courantes représentent les infections persistantes par rapport aux infections incidentes. Cependant, nos conclusions ne changent pas lorsque nous avons limité nos analyses aux infections incidentes (données non présentées). Nous avons également analysé l’ensemble de la cohorte d’utiliser le résultat binaire en cluster de la persistance, en utilisant le «numéro de visite» comme variable de panneau dans des modèles GEE logistiques. Outre le gain de précision lors de l’utilisation de multiples visites de ces mêmes femmes, les résultats de ces modèles sont en accord avec ceux des modèles de Cox qui a analysé la clairance chez les femmes individuelles par tertile de la charge virale. Par conséquent, nous concluons que le biais encourus en raison de l’inclusion des cas prévalents est minime. Nous doutons aussi que la classification erronée du statut de HPV peut avoir influé sur nos résultats, car il y avait très peu de femmes souffrant d’infections spécifiques de type persistants qui ont eu une visite intermédiaire avec un résultat de test HPV négatif et plus de 80% du même type infections persistantes se sont produites au cours consécutive visites [22].

Conclusion

En conclusion, cette étude démontre une association claire entre la charge du VPH et de la persistance du VPH-16 et 18 infections chez les jeunes femmes aux premiers stades de leur vie sexuelle. L’association entre la charge virale et la clairance de l’infection semble être de type spécifique et, à l’exception de l’âge, il ne soit pas sensiblement affectée par les caractéristiques sociodémographiques et d’autres facteurs de risque d’infection. D’autres études longitudinales sont nécessaires pour clarifier le début de l’intégration du HPV et sa relation avec la progression de la maladie.

Déclarations

Remerciements

RELATED POSTS

  • Virus du papillome humain et col de l’utérus …

    Virus du papillome humain et le cancer du col de l’utérus La bataille de la médecine moderne contre le cancer du col utérin est un conte de deux mondes. Dans le monde développé, il est une…

  • Virus du papillome humain (VPH) …

    Virus du papillome humain (VPH) Efficacité du vaccin contre la première instance cervicale pré-cancer chez les jeunes adultes avec GlaxoSmithKline (GSK) Biologicals HPV-16/18 Allocation:…

  • Papillome humain maladies liées …

    Papillome humain Maladies liées chez les individus infectés par le VIH Objet de l’examen Pour présenter des publications récentes dans le virus du papillome humain (VPH) maladies -Associated et…

  • HPV – clinique du papillome humain …

    ID de test: HPV Papillome humain (VPH) Détection ADN avec génotypage, types à risque élevé par PCR, ThinPrep génotypage individuel du virus du papillome humain (VPH) -16 et / ou HPV-18, si elle…

  • types de papillomavirus humain 16 …

    types de droits de papillomavirus 16 et 18 et le pronostic des patients atteints de stade I cancer du col utérin I Ara # X000fa; Hôpital Jorge jo, Goi Anticancer Association, Goi; # x000e1 #…

  • Le virus du papillome humain (VPH), le traitement du virus HPV.

    Papillomavirus humain (HPV) Qu’est-ce que le VPH? l’infection par le VPH est une infection sexuellement transmissible causée par le virus du papillome humain (VPH). Plus de 100 types de HPV ont…

Laisser un commentaire